RNN to model DNA sequencing classification

I have a DNA sequence dataset each mapped to a certain class. e,g

TCAGCCGAGAGCTCATCGATCGTACGT 2

ATGCAGTGCATCGATCGATCGTAGAAC 3

Where the number after the sequence specifies the type of protein this sequence belongs to.

So my question can I use KMers and 1-HOT-Coding to classify these sequences through biLSTM.

Or this is not a possible concept and I would appreciate your feedback and suggestions on this task as I am new to Deep Learning.

Thank you.

Topic sequence-to-sequence gru lstm rnn deep-learning

Category Data Science

About

Geeks Mental is a community that publishes articles and tutorials about Web, Android, Data Science, new techniques and Linux security.